Cswd40
Webcswd40-bamhⅠ-f cswd40-salⅠ-r atgggtaggagaccttgttg ttattgatcttgaagccaatc atggaggcgccgccgagtag tcagttctggggtattatttg atggagaattcgagccaag tcaaactttcagaagctgca ggggacaagtttgtacaaaaaagcag gctatgggtaggagaccttgttg ggggaccactttgtacaagaaagctg ggtcttgatcttgaagccaatc ggggacaagtttgtacaaaaaagcag WebJul 14, 2024 · WD40 proteins serve as crucial regulators in a broad spectrum of plant developmental and physiological processes, including anthocyanin biosynthesis. However, in fig (Ficus carica L.), neither the WD40 family nor any member involved in anthocyanin biosynthesis has been elucidated. In the present study, 204 WD40 genes were identified …
Cswd40
Did you know?
WebJul 14, 2024 · Overexpression of TTG1-like CsWD40 in tobacco resulted in a significant increase in anthocyanin content in the petals of the transgenic plants; when it was coexpressed with CsMYB5e in tobacco, both anthocyanin and proanthocyanidin content increased (Liu et al., 2024). WebIn tea plants, some TFs, such as CsMYB1, CsWD40, and CsGL3, have been identified to be involved in trichome initiation by forming MBW complex [21 − 24]. The MBW complex also activates many repressors, such as R3 MYB TFs CAPRICE (CPC) and TRIPTYCHON (TRY), those repressors are then transferred into neighboring cells to repress the MBW ...
WebNov 1, 2024 · Summary: The WD40-repeat proteins are a large family of scaffold molecules that assemble complexes in various cellular processes. Obtaining their structures is the … WebDownload scientific diagram CsMYC1 interacted with CsbHLH42, CsWD40, and itself. a Yeast two-hybrid assays validating the interaction of CsMYC1 with itself, CsbHLH42, and …
WebCsWD40 was then coexpressed with CsMYB5e in tobacco plants to increase levels of both anthocyanins and PAs. Furthermore, gene expression analysis revealed that CsWD40 expression in tea plants could be induced by several abiotic stresses. Taken together, these data provide solid evidence that CsWD40 partners with bHLH and MYB TFs to form … WebApr 2, 2016 · In Figs. 3 and 4, there was a 75.3 % identity at the amino acids level between the CsbHLH coding protein in Tarocco and peachbHLH3 in peach controlling anthocyanin production (Rahim et al. 2014), and there was a 87.1 % identity between the CsWD40 coding protein in Tarocco and PgWD40 in pomegranate involving into anthocyanin …
WebJun 6, 2024 · An in vitro yeast two-hybrid assay demonstrated that CsWD40 interacted with two bHLH TFs (CsGL3 and CsTT8) and two MYB TFs (CsAN2 and CsMYB5e). The …
WebView This Abstract Online; A WD40 Repeat Protein from Camellia sinensis Regulates Anthocyanin and Proanthocyanidin Accumulation through the Formation of MYB⁻bHLH⁻WD40 Ternary Complexes. Int J Mol Sci. 2024; 19(6) (ISSN: 1422-0067) Liu Y; Hou H; Jiang X; Wang P; Dai X; Chen W; Gao L; Xia T population of scotland county hsWebMar 6, 2016 · View Carrie Craig, MBA, ITILv4’s profile on LinkedIn, the world’s largest professional community. Carrie has 7 jobs listed on their profile. See the complete profile on ... sharon bb9WebFeb 15, 2024 · CsMYB1 interacts with CsGL3 and CsWD40 to form an MBW complex, which directly activates CsGL2 and then trichome development in tea plants. CsCPC … sharon beals photographyWebAn in vitro yeast two-hybrid assay demonstrated that CsWD40 interacted with two bHLH TFs (CsGL3 and CsTT8) and two MYB TFs (CsAN2 and CsMYB5e). The overexpression of … population of scotland 2022 onsWebJul 1, 2024 · The CsbHLH42, CsMYC1, CsWD40, and CsTATA-box binding protein open reading frames were introduced into the PET-32a vector … population of scotland 1950WebJan 1, 2024 · CsWD40 (Camellia sinensis tryptophan-aspartic acid repeat protein) forms a ternary WBM complex with bHLH and MYB TFs, and regulates PA and anthocyanin biosynthesis. The anthocyanins in transgenic petals increased significantly when CsWD40 was expressed heterologously in Nicotiana tabacum ( Liu et al., 2024 ). sharonbeamer1947 gmail.comWebJun 6, 2024 · To determine whether CsWD40 expression is related to temperature changes, we compared CsWD40 expression under low (10 °C) and high (50 °C) temperatures (Figure 7B). Our data indicated no … sharon bbq